Rapid Test for Bacteria in Drinking Water Review
Asian Pac J Trop Biomed. 2014 May; 4(5): 404–409.
Rapid detection of coliforms in drinking h2o of Arak city using multiplex PCR method in comparison with the standard method of culture (Well-nigh Probably Number)
Dehghan Fatemeh
1Department of Microbiology, Qom Branch, Islamic Azad Academy, Qom, Iran
Zolfaghari Mohammad Reza
1Section of Microbiology, Qom Co-operative, Islamic Azad University, Qom, Iran
Arjomandzadegan Mohammad
2Tuberculosis and Infectious Research Center and Department of Microbiology, Arak University of Medical Sciences, Islamic republic of iran
Kalantari Salomeh
threeHygiene and Quality Control Office of Markazi, Province Water and Wastewater Company, Iran
Ahmari Gholam Reza
3Hygiene and Quality Control Office of Markazi, Province H2o and Wastewater Visitor, Islamic republic of iran
Sarmadian Hossein
2Tuberculosis and Infectious Research Heart and Section of Microbiology, Arak University of Medical Sciences, Iran
Sadrnia Maryam
fourDepartment of Biology, Payame Noor University, P.O.Box 19395-4697, Tehran, I.R. of Iran
Ahmadi Azam
2Tuberculosis and Infectious Research Center and Section of Microbiology, Arak University of Medical Sciences, Iran
Shojapoor Mana
vMolecular and Medicine Research Eye, Arak University of Medical Sciences, Iran
Najarian Negin
6Section of Microbiology, Arak University of Medical Sciences, Iran
Kasravi Alii Reza
sevenDepartment of Microbiology, Islamic Azad Academy, Sciences and Research Co-operative, Arak, Iran
Falahat Saeed
2Tuberculosis and Infectious Enquiry Center and Department of Microbiology, Arak University of Medical Sciences, Islamic republic of iran
Reviewed by Dr. Andrea Clapasson
Unit of measurement of Social Dermatology, National Reference Center for Hansen'due south Affliction, University Hospital San Martino of Genoa, Largo Rosanna Benzi x, 16132 Genoa, Italy., Fax: +39 010 5556641, Electronic mail: moc.oohay@rdnplc
Received 2014 Mar 25; Accepted 2014 May 3.
Abstract
Objective
To analyse molecular detection of coliforms and shorten the time of PCR.
Methods
Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference cloth and standard bacteria. The PCR and electrophoresis parameters were inverse for reducing the performance time.
Results
Results of PCR for lacZ and uidA genes were like in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Too the total execution time, with a successful change of factors, was reduced to less than ii and a half hour.
Conclusions
Multiplex PCR method with shortened functioning time was used for the simultaneous detection of full coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and and so the positive samples could be randomly tested by MPN.
Keywords: Water, Coliforms, PCR, Rapid detection
one. Introduction
Drinking water should be free from known pathogenic micro-organisms and indicator bacteria which is a symptom for fecal contamination of water. Coliforms are the most important indicator bacteria which are considered in the bacteriological examination of water[1]. Determination of coliform equally an indicator of water contamination has been explained in 1011 standard (microbiological characteristics of water) and the use of Escherichia coli (E. coli) and other coliform leaner and those coliforms that are indicator bacteria has been recommended for the daily control of drinking water. Coliform bacteria are used for monitoring the bacteriological safe of water supplies on the basis of the realization that the presence of coliform bacteria in h2o is an indicator of potential human fecal contagion and therefore the possible presence of enteric pathogens[2].
In general, this standard focuses on three groups of leaner including coliform, thermotolerant coliform and E. coli[3]. E. coli is used every bit an indicator of fecal contamination of h2o.
Detection of indicator bacteria is one of the best ways to evaluate the effectiveness of water disinfection methods. The well-nigh important indicator bacteria, in terms of their importance, include E. coli, coliforms and other thermotolerant coliforms. The presence of these bacteria in the water is an indicator of insufficient disinfection process and also recent and frequent contagion of water with human and animal carrion[4]. Thermo tolerant coliforms, except E. coli, can enter the drinking h2o through water contaminated by industrial wastewaters and nether deterioration soil and water. Conventional methods for the detection of microbial contamination of water include methods which are based on civilization of water sample and diagnosis of β-galactosidase (using ortho-nitrophenyl-β-D-galactopyranoside) which is cumbersome, expensive and oftentimes with personnel error in routine use[5].
Civilisation-based methods have limitations such as long incubation menses (48 to 72 h), possibility of contagion with other bacteria, limited ability to detect low-growing bacteria and the inability to detect "viable simply non-cultivable bacteria" (VBNC) such every bit those stressed by chemicals in the water which has recently been considered in Iran and lack of specificity for detection of true fecal coliforms[3].
PCR has been recommended as a specific and reliable method for the detection of coliforms in drinking h2o[half-dozen]. PCR-based molecular methods have recently been considered due to their high sensitivity and specificity, quickly achieving to the relevant responses and reducing the workload of experts, peculiarly in those centers with a loftier number of samples per solar day. These methods have bang-up features due to the ability of rapid detection and being highly specific. In these methods, Deoxyribonucleic acid of target bacteria is searched using specific primers. In PCR, amplification of lacZ gene (β-galactosidase gene) to discover total coliforms and uidA cistron (β-glucuronidase cistron) to detect E. coli are specifically used[3]. Other genes such as dct A, dcuB, frdA, dcuS and dcuR are as well provided for the precise and rapid study of E. coli[7],[8].
ii. Materials and methods
ii.1. Samples
Two types of samples were used in this study. Samples for evaluation of the method and city samples consist of distribution network supply wells. Nearly 14 samples were used as control.
2.one.1. Samples for evaluation of the method
a-1) E. coli DH5α strain was used to evaluate the study conducted for the detection of E. coli using specific primers.
a-2) CRM04 and CRM07: CRM04 (QCMIC-001-04) contains 83.00±CFU/100 mL of coliform bacteria except E. coli, and CRM007 (QCMIC-007) contains (100.00±2.00) CFU/mL of coliform bacteria and E. coli.
a-3) Synthetic samples: x samples containing isolated bacteria in 250 mL distilled water.
a-4) Isolated leaner from contaminated h2o: 3 bacterial strains were isolated from positive most probable number (MPN) samples and then purified. They were identified using microbiological techniques (up to the level of identification of species). Therefore, mediums such as nutrient agar, EMB, IMVIC phenylalanine and urea were used in addition to Gram stain.
2.one.2. Composition of field samples
b-1) Samples of city water distribution network: 36 samples were collected from Arak metropolis water.
b-2) Wells that supply drinking water to the city of Arak: 41 samples were nerveless from Arak city drinking water.
b-three) Command samples: 24 purified colonies as positive control and distilled water every bit negative control.
2.two. Sample training
In this assay, 150 mL samples were passed through a filter with a diameter of 0.42 micron past the aid of a vacuum pump. To avoid possible contamination, it was conducted as class 2 laminar flow.
Separation of microbes from the filter newspaper was carried out in 2 ways:
A - Washing with distilled water.
B - Washing with diethylpyrocarbonate (DEPC).
Filter newspaper was placed in fifty cc Iso drinking glass and about 10 cc of 0.i% solution of autoclaved DEPC was added to the Iso glass. Filter was properly done 3 times with the help of sampler in the Iso glass wall through immersion and extreme turbulence. Then the solution resulted from washing were transferred into centrifuge Falcon tubes. Then, the solution was centrifuged for 10 min with 14 000 r/min.
Supernatant was removed carefully with a sampler and virtually ten cc of autoclaved saline was added to the deposits. Then information technology was centrifuged after application of vortex and turbulence. Thus, DEPC was washed from the deposits. Virtually 300 micro liters of the final deposits were transferred to a microtube i.5 and finally about 50 micro liters of the final deposit was transferred as a bacterial mass to a microtube 1.5, later on it was centrifuged at xiv 000 r/min for ii min and at the next stage, it was analyzed past PCR test. Moreover, a number of samples were insufficiently tested with or without DEPC to evaluate the necessity of its application.
From 250 mL sample in the sample container, 100 cc was used for doing MPN test, well-nigh thirty cc was used for doing turbidity test and the residuum was used for doing molecular filtrations.
In this study, three types of samples were studied:
1 - Wells and h2o distribution organization samples: MPN culture exam were first performed equally the gold standard tests, and then the samples were filtered and analyzed by PCR test.
2 - Standard bacteria: E. coli and CRM.
iii - Constructed samples: In guild to evaluate PCR, synthetic samples were used as positive examples. These samples were positive BGB (their microbial contamination with coliform was confirmed) and they are kept and expanded for setting up PCR. Later on isolation of bacteria, purified leaner were added to the negative MPN water sample. In this written report, all h2o samples sent to the laboratory culture were kept in a refrigerator for 24 h after being cultured in a lauryl tryptose broth for doing MPN.
2.3. PCR method
In this report, culture and PCR methods were compared to observe total coliform (Citrobacter, Klebsiella, E. coli and Enterobacter) in water samples. Smash survey indicated that the LacZ cistron as the β-galactosidase gene encoding is found in all these bacteria and they are relatively synonymous. Blast revealed that the gene existed in mentioned coliform bacteria.
Furthermore, uidA cistron which is a coliform-specific cistron tin specifically be used to prove the presence of Due east. coli in water samples. Therefore, forrad and contrary primers of uidA. (UAL: TGGTAATTACCGACGAAAACGG, UAR: ACGCGTGGTTACAGTCTTGCG) and lacZ (LZL: ATGAAAGCTGGCTACAGGAAGGCC, LZR: CACCATGCCGTGGGTTTCAATATT)
Genes were selected to notice the bacteria in water samples[3]. As tin can be seen in MEGA 4.0 software an 874-bp fragment was selected from nucleotides 392 to 1266 of lacZ gene by specified primers.
In gild to perform PCR test, methods of isolating Dna from purified bacteria and filtered water samples were first used in this report. And so, with the aim of accelerating and simplifying the exam process in the routine implementation, mass PCR was performed. In mass PCR method, cell mass obtained from water samples was used direct after filtration and concentration. Concluding volume of PCR was considered equally 25 mL, containing xx mL of all PCR components together with 5 mL of microbial biomass.
To avoid any errors, PCR reaction for pure colonies of isolated leaner were conducted in the same method. Colonies dissolved in 250 mL distilled h2o, and filtrated and full-bodied biomass used in PCR reaction.
2.iv. Multiplex PCR
In this written report, samples identification through detection of lacZ and uidA genes using PCR simultaneously (multiplex PCR) was canonical. Primers listed in Table one are used to amplify 876 bp and 147 bp fragments of lacZ and uidA genes, respectively. Amplification reaction in a final volume of 25 mL contains 5 mL of diluted leaner or purified DNA; and 2.5 micro liters buffer containing 10 Xmg, 1 mL dNTPs, 1.5 units of Taq enzyme and 2 mL of both primers were added to it. The PCR reaction steps were every bit follows.
Table one
Corrected programs of PCR.
| Corrected program | PCR program | Target cistron | Bacteria |
| 94-xl s | 95-x min | lacZ | Coliform leaner |
| 94-ane min | 55-ane min | ||
| 55-40 south | 72-1 min | ||
| 72-xxx southward | 72-2 min | ||
| Cycles 23 | Wheel 25 | ||
| 94-30 s | 95-10 min | uidA | E. coli |
| 94-45 s | |||
| 55-30 s | 62-45 southward | ||
| 72-45 s | |||
| 72-thirty s | 72-2 min | ||
| Cycles 23 | Cycles xxx |
Initial denaturating temperature: 94 °C for 9 min and then 23 thermal cycles for distension in PCR reaction as: 94 °C for i min, 55 °C for 1 min and 72 °C for l s and final amplification bike (extension) at 72 °C for 2 min. Corrected programs of PCR are shown in Table 1.
3. Results
In this study, Dna isolation step was removed to reduce the steps of PRC, accelerate the reaction, and nearly importantly to reduce personnel mistake; and then colony PCR method was performed successfully.
3.1. Standard strains
A) PCR performed and presented 876 bp bands in electrophoresis that shows the correct designing of this study.
B) CRMs: PCR performed on CRM 04 for searching lacZ cistron showed a 876 bp band which in turn shows the presence of coliform (except E. coli leaner) and the correct design of this report.
Moreover, 147 bp band obtained from PCR is used to study and indicate the existence of uidA gene and too the presence of E. coli bacteria in CRM07. Also, microbial analysis of CRM007 CRM 04 identified bacteria from the Coliform and E. coli family, the pure culture of which was used for doing PCR. Performing PCR on all the bacteria separately, revealed 876 bp and 147 bp bands which demonstrates the applicability of the proposed method for the detection of drinking water contamination (Figure 1). Bacteria that cause water contamination which are the members of total coliform grouping were purified and isolated from samples of contaminated drinking water and samples with positive MPN; and detection tests were led to the identification of four bacterial species of E. coli, Klebsiella, pneumonia, Enterobacter and Pseudomonas aeruginosa.
PCR and multiplex PCR distension of LacZ and gene uidA.
Lane 2-multiplex PCR amplification of LacZ and uidA cistron from contaminated water with coliformm bacteria (E.coli); Lane 1 ladder, lane 3-4 PCR LacZ distension from contaminated water with coliformm bacteria (Enterobacter and Klebsiella ).
Results of PCR for lacZ and uidA genes on these samples confirmed the occurrence of 876 bp and 147 bp bands.
3.2. Results of evaluating the water samples
The study was conducted on 77 samples of waters. Of the samples sent to the laboratory, 41 samples were taken from the wells, 36 samples were taken from Arak city water. Nigh 12 samples were positive control samples and 12 samples were also considered as negative control. Results of performing MPN and PCR on all the samples are shown in Table two and Figure i.
Tabular array 2
Results of MPN and PCR microbial tests on samples taken from different parts of drinking water production and distribution networks of Arak city in the wintertime of 2011.
| Methods | Quantity | MPN | PCR | ||
| Positive | Negative | Positive | Negative | ||
| Samples of urban center water distribution network | 36 | 0 | 36 | five | 31 |
| Wells that supply drinking water to the city of Arak | 41 | 0 | 41 | 0 | 41 |
| Control samples | 24 | Positive control samples: 12 | |||
| Negative control samples: 12 | |||||
As it is obvious in Tabular array 2, of the total samples sent to the laboratory, PCR results of 5 samples were positive, whereas the MPN results have been reported equally negative. The results of doing PCR and MPN tests on other samples of the water arrangement were similar with each other and both tests were negative.
Almost the water samples taken from the wells sent to the laboratory, following results were reported. Of 41 taken samples, two samples had positive results in both the MPN and PCR tests and about the rest of the sample taken from wells, the results of both tests were reported negative which indicates the compatibility of the both tests.
4. Discussion
In this report, the lacZ gene was successfully used as a target molecule for the detection of coliform grouping leaner. The indicator of the existence of total coliform in the samples was determined after observing 876 bp gene fragment. Moreover, the uidA factor which is specifically found in E. coli 876 bp (among coliforms) was used as a target molecule for the detection of Due east. coli bacteria. And so a gene fragment effectually 174 bp was obtained using designed primers[nine].
Molecular techniques are accurate, rapid and sensitive methods for the study of specific pathogenic bacteria. These tools can be used to accurately clarify the drinking water performance of the elimination of pathogens in drinking h2o and treatment of water used for drinking[x].
Civilization methods for the detection of coliforms have limitations such every bit long incubation period, interactions with other microorganisms, lack of precision and required sensitivity and poor identification of VBNC bacteria. As an authentic and rapid method for the detection of coliforms, molecular methods accept been proposed[11].
PCR tin can detect coliform bacteria using lacZ gene (gene β-galacotozidase) and Eastward. coli bacteria using uidA gene (β-glucuronidase factor)[12]. In the present study, common ways to identify coliforms are compared with the new molecular methods and the sensitivity and precision of these methods is evaluated in practical awarding. In this study, unlike items such as molecular method for reducing the book of routine operations in the Iran'south h2o bacteriology laboratory, reduction in the costs of samples analysis, increase in the accuracy and possible coverage of VBNC bacteria in the water by molecular methods are presented. Plan targeting is based on PCR method in the initial screening of all samples accustomed per day. As loftier pct of sample accepted each solar day have negative test results, initial screening by PCR, removal of samples having negative test results and focus of tests on positive samples cause reduction in the consumption of a high volume of medium and interest of the practiced in the cosmos and removal of media[13].
To prove the correctness of the performance of the two lacZ and uidA genes, at first standard strains and then reference strain (CRM) were studied and the occurrence of bands in electrophoresis was confirmed. The MPN was used every bit the gilded standard to minimize any error in interpretation of results. To farther confirm the results, bacteria isolated in MPN examination were identified up to the extent of species and and then purified and identified bacteria were successfully undergone molecular evaluation with the aid of these two genes. Given that the entire study was planned with the aim of making routine tests in order to perform performance in the Iran's water microbiology laboratories, the results of this study prove the operability of the usage of molecular methods in routine applications for the microbial assessment of drinking h2o[14].
Filtration and sample preparation method was designed based on samples accustomed per mean solar day. Of the advantages of PCR organization, sensitivity [detection of target bacteria in minimum concentration, specificity of this method for target microorganisms, charge per unit of doing test from the fourth dimension of sample collection until analysis completion (less than four h)], and the power to simultaneously detect multiple bacterial (including general specific species and a number of target specific pathogens) can be mentioned. With regard to the emerging problem of living bacteria but non existence able to be cultured (VBNC) and their role in public wellness, the results of this study indicated that the provided molecular methods may too exist able to notice VBNC bacteria[ten]. On the other hand, from the perspective of economical justification, according to the conducted studies, costs of civilization methods are higher than the costs of PCR method.
In the PCR method, preparation of the medium for culturing was removed and the device depreciation costs were reduced. Time spent by experts and afterward personnel fault are also minimized. The mentioned PCR method is able to cover three steps of MPN exam in the shortest time and with high sensitivity (detecting total coliforms, fecal coliforms and E. coli)[xi],[15]. But, in the first operational stage, PCR can be used for the primer screening of the accepted water samples per twenty-four hours. Samples identified equally having positive examination results by PCR within a few hours, are entered into the phase of cultivation and counting. In this project, the execution fourth dimension of China was reduced with the aim of reducing the performance time. For this reason, the programme of amplification was inverse with the fourth dimension reduction and so that the replication time fell from 2 h and 15 min to an hour.
Bands resulted from this method have such sizes that remove the demand for the utilize of polyacrylamide for electrophoresis. Therefore, with the increase in the voltage during the utilise of agarose gel, electrophoresis time is also decreased. When using in vitro cultivation routine methods, it is probable that in the virtually cases the PCR exam shows simulated negative results due to the low number of pathogenic bacteria in water (less than detectable by civilisation) or the loss of chromosomes of leaner at different stages of purification, in addition to being energy consuming of routine methods of in vitro cultivation[16]. In molecular methods, detection telescopic is much less than medium and bacteria are detected even in small number. On the other paw, the only existing way to find VBNC is molecular methods. In this written report, with the aim of reducing the false negative responses, samples filtration was used based on the method proposed past WHO[6],[17].
Also simultaneous detection of total coliform bacteria for East. coli in drinking water has been carried out in this study using lacZ and uidA genes. Detection using agarose gel electrophoresis has created a ring of 876 bp for the lacZ gene for the all of coliform bacteria and a ring of 147 bp for uidA factor and a band of 876 bp for lacZ cistron for all species of East. coli[10],[eighteen].
In this study, rapid method for the simultaneous detection of total coliforms and E. coli in drinking water was designed using PCR method and tested in the routine piece of work. Validity of the results and concurrent comparison between them and conventional method of cultivation, application of methods on standard samples, bacteria isolated from positive MPN and CRM samples in dissimilar wells, water reservoir and system were evaluated and confirmed. Given the volume of water incoming to wastewater laboratories, it was tried to reduce the exam execution time to a possible minimum level. Thus, given the particular sensitivity of the public health, multiplex PCR method tin exist used at to the lowest degree as an initial screening test. Thus, the samples showing positive results in this test can exist randomly tested for MPN.
Acknowledgments
The authors would particularly like to thank all colleagues at Tuberculosis and Pediatric Infectious Enquiry Center (TPI) of Arak University of Medical Sciences for their assistance. Supported by the Ministry of Ability of I.R.Islamic republic of iran. Grant No. 201.
Notes
Comments
Groundwork
With the increasing of world population and information technology'southward thickness in built-up area, drinking h2o is condign a resources about valuable. Outbreaks, caused by infected water, can exist a serious problem of health public. To reduce risk of infection, it is of import to use reliable, inexpensive, rapid and robust protocols to analyze a lot of samples in piffling time.
Enquiry frontiers
This paper evaluates a method for rapid analysis of drinking water for homo use. To be precise, the samples came from distribution network supply wells of the metropolis of Arak. The results obtained by multiplex PCR are compared with standard cultural methods. The written report underlined the detection of sentry microorganisms that may indicate the presence of faecal contamination in water sources.
Related reports
This piece of work is interesting for rapidity of assay and for the possible epidemiological implication. It does not contrast with other reports, east.k. Kuo et al. (2010) and Hiraka et al. (2009). It should be useful to know the detection limits of these target genes. These values are depending by selected primers.
Innovations and breakthroughs
The present study has shown that a accurate monitoring should non merely be based on standard cultural method but it should be implemented with other tests. Rapid laboratory investigations tools are indispensable for an accurate monitoring, then assay proposed is very interesting.
Applications
The maintenance of sewer and h2o networks in cities is very expensive. Moreover, not all urban centers accept sewage systems. This creates issues, which tin exist monitored and programmed merely in a systemic manner. Using methods more sensitive and rapid should be of assistance in these circumstances.
Peer review
The authors scrupulously highlight any potential of molecular biology techniques and they effort to focus the limits on the standard cultural methods. For example, long incubation catamenia, express ability to detect low-growing bacteria and the inability to observe "viable only non-cultivable bacteria" etc. In the whole the study is interesting.
Footnotes
Foundation Project: Supported by the Ministry of Ability of I.R.Islamic republic of iran (Grant No. 201).
Disharmonize of interest argument: We declare that we have no conflict of involvement.
References
two. Bej AK, Steffan RJ, DiCesare J, Haff L, Atlas RM. Detection of coliform bacteria in h2o by polymerase concatenation reaction and gene probes. Appl Environ Microbiol. 1990;56(two):307–314. [PMC free commodity] [PubMed] [Google Scholar]
3. Tantawiwat S, Tansuphasiri U, Wongwit W, Wongchotigul V, Kitayaporn D. Development of multiplex PCR for the detection of total coliform bacteria for Escherichia coli and Clostridium perfringens in drinking h2o. Southeast Asian J Trop Med Public Health. 2005;36(i):162–169. [PubMed] [Google Scholar]
4. Rodríguez DC, Pino Northward, Peñuela G. Microbiological quality indicators in waters of dairy farms: detection of pathogens by PCR in real fourth dimension. Sci Total Environ. 2012;427-428:314–318. [PubMed] [Google Scholar]
5. Tharannum S, Sunitha Southward, Nithya J, Chandini Yard, Vanitha J, Manjula TS, et al. Molecular confirmation of the presence of coliforms in drinking water using polymerase chain reaction. Kathmandu Univ J Sci Eng Technol. 2009;5(2):130–136. [Google Scholar]
half-dozen. Clifford RJ, Milillo M, Prestwood J, Quintero R, Zurawski DV, Kwak YI, et al. Detection of bacterial 16S rRNA and identification of four clinically of import bacteria past existent-time PCR. PLoS One. 2012;7(11):e48558. [PMC free article] [PubMed] [Google Scholar]
7. Abo-Amer AE, Soltan el-SM, Abu-Gharbia MA. Molecular approach and bacterial quality of drinking water of urban and rural communities in Egypt. Acta Microbiol Immunol Hung. 2008;55(3):311–326. [PubMed] [Google Scholar]
viii. Mannapperuma WM, Abayasekara CL, Herath GB, Werellagama DR, Tanski HH. Comparison of bacteriological methods for detecting and enumerating total coliforms and Escherichia coli in water. Res J Microbiol. 2011;6:851–861. [Google Scholar]
9. Girones R, Ferrús MA, Alonso JL, Rodriguez-Manzano J, Calgua B, Corrêa Ade A, et al. Molecular detection of pathogens in h2o--the pros and cons of molecular techniques. Water Res. 2010;44(15):4325–4339. [PubMed] [Google Scholar]
ten. Chung JW, Foppen JW, Lens PN. Development of low toll two-footstep reverse transcription-quantitative polymerase chain reaction assays for rotavirus detection in foul surface water drains. Food Environ Virol. 2013;five(2):126–133. [PubMed] [Google Scholar]
11. Park SH, Hanning I, Jarquin R, Moore P, Donoghue DJ, Donoghue AM, et al. Multiplex PCR assay for the detection and quantification of Campylobacter spp., Escherichia coli O157:H7, and Salmonella serotypes in water samples. FEMS Microbiol Lett. 2011;316(1):7–15. [PubMed] [Google Scholar]
12. EL-Jakee J, Moussa EI, Mohamed KF, Mohamed G. Using molecular techniques for label of Escherichia coli isolated from water sources in Arab republic of egypt. Global Veterinaria. 2009;3(5):354–362. [Google Scholar]
xiii. Fode-Vaughan KA, Maki JS, Benson JA, Collins ML. Directly PCR detection of Escherichia coli O157:H7. Lett Appl Microbiol. 2003;37(3):239–243. [PubMed] [Google Scholar]
15. Abtahi H, Ghannadzadeh One thousand, Salmanian AH, Rad EG, Karimi M, Molaei N. Comeback of PCR in detection of coliform in h2o pollution. J Arak Univ Med Sci. 2008;11(3):1–7. [Google Scholar]
16. Heijnen L, Medema G. Quantitative detection of East. coli, E. coli O157 and other shiga toxin producing E. coli in water samples using a culture method combined with real-time PCR. J H2o Health. 2006;4(iv):487–498. [PubMed] [Google Scholar]
17. Kuo JT, Cheng CY, Huang HH, Tsao CF, Chung YC. A rapid method for the detection of representative coliforms in water samples: polymerase concatenation reaction-enzyme-linked immunosorbent analysis (PCR-ELISA) J Ind Microbiol Biotechnol. 2010;37(3):237–244. [PubMed] [Google Scholar]
18. Hidaka A, Hokyo T, Arikawa K, Fujihara Due south, Ogasawara J, Hase A, et al. Multiplex real-time PCR for exhaustive detection of diarrhoeagenic Escherichia coli. J Appl Microbiol. 2009;106(2):410–420. [PubMed] [Google Scholar]
Manufactures from Asian Pacific Journal of Tropical Biomedicine are provided hither courtesy of Prc Humanity Technology Publishing Firm
Source: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3985057/
0 Response to "Rapid Test for Bacteria in Drinking Water Review"
Post a Comment